Skip to main content

Advertisement

Table 1 RT-PCR assay characteristics and primer sequences

From: Differential expression of P2X7 receptor and IL-1β in nociceptive and neuropathic pain

Gene Primer sequence
TBP-87 for 5′ GAACATCATGGATCAGAACAACA 3′
rev 5′ ATAGGGATTCCGGGAGTCAT 3′
SDHA-132 for 5′ GAGGCAGGGTTTAATACAGCA 3′
rev 5′ CCAGTTGTCCTCCTCCATGT 3′
P2RX7 Roche RealTime Ready Single Assay ID 106724