Skip to main content

Table 2 Primers used for real-time polymerase chain reaction (qPCR)

From: Oncostatin M promotes excitotoxicity by inhibiting glutamate uptake in astrocytes: implications in HIV-associated neurotoxicity

Gene Forward primer (5′-3′) Backward primer (5′-3′)
GAPDH ATGGCCTTCCGTGTTCCTAC GCCTGCTTCACCACCTTCTT
HPRT1 GACTTGCTCGAGATGTCA TGTAATCCAGCAGGTCAG
GLAST CCTTCGTTCTGCTCACGGTC TTCACCTCCCGGTAGCTCAT
GLT-1 GTGCAAGCCTGTTTCCAGC GCCTTGGTGGTATTGGCCT
OSM GTGGCTGCTCAACTCTTCC AGAGTGATTCTGTGTTCCCCGT
OSMR-β ATTCTGGACACGAAGAGGTCAAG TTCCACTGCAAATCACAGCG
gp130 TGGAAGGCACTGCCTCTTTC CTAGAGACGCGACATAGCGGT
HIV LTR GGTCTCTCTGGTTAGACCAGAT CTGCTAGAGATTTTCCACACTG
IL-1β GGCAGGCAGTATCACTCATT AAGGTGCTCATGTCCTCATC
TNF-α GACGTGGAACTGGCAGAAGA GCCACAAGCAGGAATGAGAA
COX-2 CTCCCTGAAGCCGTACACAT CCCAAAGATAGCATCTGGA
iNOS AAGGCCACATCGGATTTCAC GATGGACCCCAAGCAATACTT
GFAP GTTTCATCTTGGAGCTTCTGC GGAGGTGGAGAGGGACAAC
IL-6 CCGGAGAGGAGACTTCACAG TCCACGATTTCCCAGAGAAC