Skip to main content

Table 1 List of primers used for real-time RT-PCR analysis

From: TLR2 and TLR9 modulate enteric nervous system inflammatory responses to lipopolysaccharide

Genes Sense primer Antisense primer Reference
rS6 CCAAGCTTATTCAGCGTCTTGTTACTCC CCCTCGAGTCCTTCATTCTCTTGGC NM_017160
rTLR2 CAGATGGCCAGAGGACTCA AATGGCCTTCCCTTGAGAG ENSRNOT00000013025.3
rTLR4 GGATGATGCCTCTCTTGCAT TGATCCATGCATTGGTAGGTAA NM_019178.1
rTLR9 TCCGTGACAATCACCTCTCTT GGTCCAGGTCTCGCAGATT NM_198131.1