Skip to main content

Table 1 Primer sequences

From: High-fat diet feeding differentially affects the development of inflammation in the central nervous system

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
CD11b GAACATCCCATGACCTTCCA GCTGGGGGACAGTAGAAACA
CD11c ACGTCAGTACAAGGAGATGTTGGA ATCCTATTGCAGAATGCTTCTTTACC
CD68 CTTCCCACAGGCAGCACAG AATGATGAGAGGCAGCAAGAGG
Claudin 1 TTCGCAAAGCACCGGGCAGATACA GCCACTAATGTCGCCAGACCTGAAA
Claudin 5 GTTAAGGCACGGGTAGCACT GTACTTCTGTGACACCGGCA
COX-2 TGACCCCCAAGGCTCAAATAT TGAACCCAGGTCCTCGCTTA
F4/80 TGACAACCAGACGGCTTGTG CAGGCGAGGAAAAGATAG
GFAP TTCGCACTCAATACGAGGCA CTCCAGATCGCAGGTCAAG
IL-1β TCGCTCAGGGTCACAAGAAA CATCAGAGGCAAGGAGGAAAAC
IL-6 ACAAGTCGGAGGCTTAATTACACAT TTGCCATTGCACAACTCTTTTC
iNOS AGGTACTCAGCGTGCTCCAC GCACCGAAGATATCTTCATG
LBP AGTCCTGGGAATCTGTCCTTG ACTTGTGCCTTGTCTGGATG
MCP-1 GCAGTTAACGCCCCACTCA TCCAGCCTACTCATTGGGATCA
Occludin ATGTCCGGCCGATGCTCTC TTTGGCTGCTCTTGGGTCTGTAT
RPL19 TGACCTGGATGAGAAGGATGAG CTGTGATACATATGGCGGTCAATC
Serpina3n GGACATTGATGGTGCTGGTGAAT CTCCTCTTGCCCGCGTAGAA
TNFα CCACCACGCTCTTCTGTCT TCCAGCTGCTCCTCCACTT
ZO-1 TTTTTGACAGGGGGAGTGG TGCTGCAGAGGTCAAAGTTCAAG