Skip to main content

Table 2 Primers (Invitrogen) used for expression analyses of cytokines and chemokines by qPCR

From: 1-Oleyl-lysophosphatidic acid (LPA) promotes polarization of BV-2 and primary murine microglia towards an M1-like phenotype

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Product length (bp)
Ccl5 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC 104
Cxcl2 AGTGAACTGCGCTGTCAATG GCCCTTGAGAGTGGCTATGA 126
Il1β TGTGAAATGCCACCTTTTGA GGTCAAAGGTTTGGAAGCAG 94
Il6 TGATGCACTTGCAGAAAACA ACCAGAGGAAATTTTCAATAGGC 109
Tnfα CCACCACGCTCTTCTGTCTAC AGGGTCTGGGCCATAGAACT 103