Skip to main content

Table 1 Primers used for qPCR

From: Polysaccharides from Ganoderma lucidum attenuate microglia-mediated neuroinflammation and modulate microglial phagocytosis and behavioural response

Gene Forward Reverse
IL-1β GTTGACGGACCCCAAAAGAT AAGGTCCACGGGAAAGACAC
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC
iNOS CCCTTCAATGGTTGGTACATGG ACATTGATCTCCGTGACAGCC
Arg1 GAACACGGCAGTGGCTTTAAC TGCTTAGCTCTGTCTGCTTTGC
TGFβ CACTGATACGCCTGAGTG GTGAGCGCTGAATCGAAA
MCP-1 ATGCAGGTCCCTGTCATGCTTC TTCTGATCTCATTTGGTTCCGA
C1q GGCTGGAGCATCCAGTTTGA GTCATGGTCAGCACACAGGC