Skip to main content

Advertisement

Table 1 qPCR primer sequences

From: Microglia amplify inflammatory activation of astrocytes in manganese neurotoxicity

Gene Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Reference
β-actin NM_00793.3 GCTCTCCTATGTTGCTCTAG CGCTCCTTGCCAATACTC a
Bdnf NM_001048139.1 TTACCTGGATGCCGCAAACAT TGACCCACTCGCTAATACTGTC b
Caspase 1 NM_009807.2 ATGAATACAACCACTCGTACAC ATCCTCCAGCAGCAACTTC c
Ccl2 NM_011331.2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT d
Ccl5 NM-013653.3 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC d
Cd16 NM_010188.4 TTTGGACACCCAGATGTTTCAG GTCTTCCTTGAGCACCTGGATC e
Cd206 NM_008625.1 TCTTTGCCTTTCCCAGTCTCC TGACACCCAGCGGAATTTC e
Cd32 NM_010187.2 AATCCTGCCGTTCCTACTGATC GTGTCACCGTGTCTTCCTTGAG e
Cd86 NM-019388 TTGTGTGTGTTCTGGAAACGGAG AACTTAGAGGCTGTGTTGCTGGG e
Igf-1 NM_010512.4 AAAGCAGCCCGCTCTATCC CTTCTGAGTCTTGGGCATGTCA b
Il-1β NM_008361.3 GCAGCAGCACATCAACAAAG CACGGGAAAGACACAGGTAG c
Il-6 NM_031168.1 GACAACTTTGGCATTGTGG ATGCAGGGATGATGTTCTG b
Nos2 NM_010927.2 TCACGCTTGGG CTTGTT CAGGTCACTTTGGTAGGATTTG a
Tnf NM_013693.3 GTTGCCTGATTCTTGCTTCTG GCCACCACTTGCTCCTAC c
  1. aSequences taken from [39]
  2. bSequences obtained from PrimerBank
  3. cPrimers designed using NCBI/Primer-BLAST
  4. dSequences taken from [39]
  5. eSequences taken from [18]