Skip to main content

Table 1 Primer sequences used for qPCR

From: Salutary effects of glibenclamide during the chronic phase of murine experimental autoimmune encephalomyelitis

Gene RefSeq Primer sequence (5′ to 3′)
Forward Reverse
Abcc8 NM_011510.3 GCCAGCTCTTTGAGCATTGG AGGCCCTGAGACGGTTCTG
Trpm4 NM_175130.4 TGTTGCTCAACCTGCTCATC GCTGTGCCTTCCAGTAGAGG
Tnf NM_013693 GATCGGTCCCCAAAGGGATG AGATGATCTGAGTGTGAGGGT
Baff NM_033622 CTACCGAGGTTCAGCAACACCA GAAAGCGCGTCTGTTCCTGTGG
Ccl2 NM_011333 GCTACAAGAGGATCACCAGCAG GTCTGGACCCATTCCTTCTTGG
Nos2 NM_010927 TGGAGCGAGTTGTGGATTGTC GGGCAGCCTCTTGTCTTTGA
Rps18 NM_011296 CGGAAAATAGCCTTCGCCATCAC ATCACTCGCTCCACCTCATCCT