Skip to main content

Table 1 Primer sequences for mouse-specific transcripts

From: Adipose stromal vascular fraction attenuates TH1 cell-mediated pathology in a model of multiple sclerosis

Transcript Forward sequence (5’-3’) Reverse sequence (5’-3’)
Interleukin-2 receptor β GGCTCTTCTTGGAGATGCTG GCCAGAAAAACAACCAAGGA
Interleukin-23 CAAAGGATCCGCCAAGGTCT GGAGGTGTGAAGTTGCTCCA
Foxp3 TTGGCCAGCGCCATCTT TGCCTCCTCCAGAGAGAAGTG
STAT1 CTTATTCCATGGA CAAGGTTTTG GGTGCTTCTTAATGAGCTCTAGG
T-bet AACCAGTATCCTGTTCCCAGC TGTCGCCACTGGAAGGATAG
GATA-3 CTCCTTTTTGCTCTCCTTTTC AAGAGATGAGGACTGGAGTG