Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Inhibition of peripheral macrophages by nicotinic acetylcholine receptor agonists suppresses spinal microglial activation and neuropathic pain in mice with peripheral nerve injury

Gene Forward (5′ to 3′) Reverse (5′ to 3′)
GAPDH GGGTGTGAACCACGAGAAAT ACTGTGGTCATGAGCCCTTC
ACTB CAGCTGAGAGGGAAATCGTG TCTCCAGGGAGGAAGAGGAT
IL-1β AAAGCTCTCCACCTCAATGG AGGCCACAGGTATTTTGTCG
Iba1 ATGAGCCAAAGCAGGGATTT TTGGGATCATCGAGGAATTG
CD11b GTTTCTACTGTCCCCCAGCA GTTGGAGCCGAACAAATAGC
CD68 ACTCATAACCCTGCCACCAC CCAACAGTGGAGGATCTTGG
IRF5 ACACTGAAGGGGTGGATGAG CGAGGGCCATCATAGAACAG
IRF7 GTGTGTCCCCAGGATCATTT CTGCAGAACCTGAAGCAAGA
CCL3 CTGCCCTTGCTGTTCTTCTC GTGGAATCTTCCGGCTGTAG