Skip to main content

Table 1 All gene primer sequences (Generay Biotech Co., Ltd., Shanghai, China) applied in the qPCR analysis

From: β-arrestin2 functions as a key regulator in the sympathetic-triggered immunodepression after stroke

Gene (GenBank)   Primer sequence (5′-3′)
IL-6 (NM_000600.3) Forward CAGACAGCCACTCACCTC
Reverse CTCAAACTCCAAAAGACCAG
IL-10 (NM_000572.2) Forward GGAGAACCTGAAGACCCT
Reverse TGATGAAGATGTCAAACTCACT
IL-1β (NM_000576.2) Forward ACCACCACTACAGCAAGG
Reverse AAAGATGAAGGGAAAGAAGG
IL-8 (NM_000584.3) Forward GCATAAAGACATACTCCAAACC
Reverse AAACTTCTCCACAACCCTCT
TNF-α (NM_000594.3) Forward TGTAGCAAACCCTCAAGC
Reverse GGACCTGGGAGTAGATGAG
NF-κB (NM_001165412.1) Forward CCACAAGCAAGAAGCTGAAG
Reverse AGATACTATCTGTAAGTGAACC
IκBα (NM_020529.2) Forward ACACTAGAAAACTTCAGATGC
Reverse ACACAGTCATCATAGGGCAG
ARRB2 (NM_001257331.1) Forward TGTGGACACCAACCTCATTG
Reverse TCATAGTCGTCATCCTTCATC
β-actin (NM_001101.3) Forward GCACCACACCTTCTACAATGAG
Reverse ATAGCACAGCCTGGATAGCAAC