Skip to main content

Advertisement

Table 2 Primer pairs for qRT-PCR analysis

From: Laquinimod protects the optic nerve and retina in an experimental autoimmune encephalomyelitis model

Oligonucleotides Sequence 5′ to 3′
ß-actin_fwd ctaaggccaaccgtgaaaag
ß-actin_rev accagaggcatacagggaca
Brn-3a_fwd ctccctgagcacaagtaccc
Brn-3a_rev ctggcgaagaggttgctc
CD68_fwd tgatcttgctaggaccgctta
CD68_rev taacggcctttttgtgagga
Cyclophilin_fwd ttcttcataaccacagtcaagacc
Cyclophilin_rev tccaccttccgtaccacatc
Iba1_fwd ggatttgcagggaggaaaa
Iba1_rev tgggatcatcgaggaattg
GFAP_fwd acagactttctccaacctccag
GFAP_rev ccttctgacacggatttggt
Tmem119_fwd gtgtctaacaggccccagaa
Tmem119_rev agccacgtggtatcaaggag
AMWAP_fwd tttgatcactgtggggatga
AMWAP_rev acactttctggtgaaggcttg
  1. The primer pairs listed in the table were used in qRT-PCR experiments. ß-actin and cyclophilin served as housekeeping genes for retinal samples. Fwd forward, rev reverse