Skip to main content

Table 1 Primer set list for qPCR

From: Chronic constriction injury-induced microRNA-146a-5p alleviates neuropathic pain through suppression of IRAK1/TRAF6 signaling pathway

Target gene Primer sequence 5′-3′
IRAKl Forward GCTCCCAGACCCATTCTGAG
Reverse CTCTGGGCTGGCTTGATGG
TRAF6 Forward GCCCATGCCGTATGAAGAGA
Reverse ACTGAATGTGCAGGGGACTG
β-actin Forward CACCCGCGAGTACAACCTTC
Reverse CCCATACCCACCATCACACC