Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences applied for q-PCR

From: Vitexin reduces epilepsy after hypoxic ischemia in the neonatal brain via inhibition of NKCC1

Primer Forward prime 5′-3′ Reverse prime 5′-3′
NKCC1 AGACTTCAACTCAGCCACTGT CAAGGTCAAACCTCCATCATCA
ZO-1 TTGCCACACTGTGACCCTAA GTTCACACTGCTTAGTCCAGC
IL-1β GGAACCCGTGTCTTCCTAAAG CTGACTTGGCAGAGGACAAAG
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTACTTC
TNF CCAACAAGGAGGAGAAGTTCC CTCTGCTTGGTGGTTTGCTAC
β-actin GATCAAGATCATTGCTCCTCCTG AGGGTGTAAAACGCAGCTCA