Skip to main content

Advertisement

Table 1 Primers used for the analysis of proinflammatory cytokines by RT-PCR. All primers were designed using the OligoAnalyzer 3.1, provided by Integrated DNA Technologies

From: Ex vivo model of epilepsy in organotypic slices—a new tool for drug screening

Gene Acession number Primer sequence (5′–3′) PCR fragment size (bp)
Proinflammatory cytokines
IL-1β NM_031512.2 Forward: TCCTCTGTGACTCGTGGGAT 309
Reverse: GTTTGGGATCCACACTCTCCA
TNF-α NM_012675.3 Forward: ATGGGCTCCCTCTCATCAGT 106
Reverse: GCTTGGTGGTTTGCTACGAC
IL-6 NM_012589.2 Forward: GCAAGAGACTTCCAGCCAGT 203
Reverse: TTGCCATTGCACAACTCTTTTCT
Housekeeping gene
GAPDH NM_017008 Forward: GTTTGTGATGGGTGTGAACC 170
Reverse: TCTTCTGAGTGGCAGTGATG
  1. The table indicates the gene, the gene accession number, the primer sequence, and the PCR fragment size