Skip to main content

Table 4 Sequences of specific primer sets, used for Q-PCR analysis

From: The human microglial HMC3 cell line: where do we stand? A systematic literature review

Genes Forward primer Reverse primer Product length (Base pair) NCBI Reference sequence mRNA variants
Lineage markers
 IBA1 F150–170: TCATGTCCCTGAAACGAATG R265–285: CCAGCATCATCCTGAGAAAG 136 bp NM_032955.2 1, 3 and 4
 CD14 F636–655: CGCTCGAGGACCTAAAGATA R711–693: AAGCTGGAAAGTGCAAGTC 76 bp NM_001174105.1 4
 CX3CR1 F187-207: GGCTGAGGCCTGTTATATTG R315–333: TGACACTCTTGGGCTTCT 147 bp NM_001171174.1 1, 2, 3 and 4
 CCR2 F425–445: CCACAAGCTGAACAGAGAAA R558–579: GGGAGCACCGTAATCATAATC 155 bp NM_001123041.2 A and B
 P2RY12 F674–692: AGACCACCAGGCCATTTA R837–858: CAGACTAGACCGAACTCTGAT 185 bp NM_022788.4 1 and 2
 CSF1R F344–364: CAGGGAATCCCAGTGATAGA R470–489: TGGAGCCATCAGAGTACAG 146 bp NM_005211.3 2, 3 and 4
 TMEM119 F408–428: ACTTCCTGGATGGGATAGTG R542–562: GGGAAGGACGATGGGTAATA 155 bp NM_181724.2  
 TREM2 F588–607: AGCCTCTTGGAAGGAGAAA R719–737: AGTTCACTGGGTGGATGT 150 bp NM_018965.3  
Inflammatory genes
 IL-6 F394–414: CCTTCCAAAGATGGCTGAAA R 524–543: TGGCTTGTTCCTCACTACT 150 bp NM_000600.4 1 and 2
 TNFα F1305–1324: GAGCCAGCTCCCTCTATTTA R 1485–1466: GGGAACAGCCTATTGTTCAG 181 bp NM_000594.3  
 IL-1β F407-427: CATGGGATAACGAGGCTTATG R 556–537: CCACTTGTTGCTCCATATCC 150 bp NM_000576.2  
 COX2 (Rat/ Human) F1384–1407:TTGCTGGCAGGGTTGCTGGTGGTA R1469–1449: CATCTGCCTGCTCTGGTCAATCGAA 86 bp NM_000963.4  
 NOS2 (Rat/ Human) F 1701–1725: CTGCATGGAACAGTATAAGGCAAAC R 1929–1905: AGACAGTTTCTGGTCGATGTCATGA 229 bp AF049656.1  
 TGFβ: F2423-2442: CAGTCACCATAGCAACACTC R 2583–2567: CCTGGCCTGAACTACTATCT 161 bp NM_000660.5  
 ARG1 F 905–925: GGGCTACTCTCAGGATTAGAT R 1016–996: CGAAACAAGCCAAGGTTATTG 112 bp NM_001244438.1 1 and 2
Normalization
 ACTB F590–613: ACGTTGCTATCCAGGCTGTGCTAT R830–807: TTAATGTCACGCACGATTTCCCGC 241 bp NM_001101.3