Skip to main content

Table 2 Primers used for quantitative analysis of gene expression

From: Netrin-1 attenuates brain injury after middle cerebral artery occlusion via downregulation of astrocyte activation in mice

Gene symbol Forward primer 5′–3′ Reverse primer 5′–3′
DCC CTCTTCACAGGATTGGAGAAAGGC GAGGAGGTGTCCAACTCATGATG
UNC5H2 TGGATCTTTCAGCTCAAGACCCAG AAGATGGCCAGCTGGAGCCG
A2B TTGGCATTGGATTGACTC TATGAGCAGTGGAGGAAG
IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT
IL-12β TGGTTTGCCATCGTTTTGCTG ACAGGTGAGGTTCACTGTTTCT
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA