Skip to main content

Advertisement

Table 1 Primers used for RT-qPCR assay

From: ZIKV infection activates the IRE1-XBP1 and ATF6 pathways of unfolded protein response in neural cells

Gene Forward primer (5′→3′) Reverse primer (5′→3′)
ZIKV AARTACACATACCARAACAAAGTG TCCRCTCCCYCTYTGGTCTTG
gadd34-human GATGGCATGTATGGTGAGCG GAGACAAGGCAGAAGTAGAG
atf4-human CACCGCAACATGACCGAAAT GACTGACCAACCCATCCACA
chop-human GAACCAGGAAACGGAAACAG ATTCACCATTCGGTCAATCA
xbp1s-human AAGAACACGCTTGGGAATGG CTGCACCTGCTGCGGAC
T-xbp1-human GACAGAGAGTCAAACTAACGTGG GTCCAGCAGGCAAGAAGGT
edem-1-human CTGGTGGAATTTGGGATTCT GTATCATTGCTCCGGAGG
gapdh-human GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA
bip-mouse CCATCCCGTGGCATAAAC GACTCCTCCCACAGTTTCA
ire1 GGACAGGCTCAATCAAATGG CGGTCAGGAGGTCAATAACA
atf6 TCGGTCAGTGGACTCTTATT CCAGTGACAGGCTTATCTTC
gadd34-mouse CCGCTTATCCCACATCAC GGTTTGTATCCCGGAGCT
atf4-mouse TTAGAGCTAGGCAGTGAAGTT CTGTCATTGTCAGAGGGAGT
chop-mouse CACATCCCAAAGCCCTCG CGTTCTCCTGCTCCTTCTC
xbp1s-mouse CTGAGTCCGCAGCAGGTG GACCTCTGGGAGTTCCTCCA
T-xbp1-mouse GGGACTACAGGACCAATAA ACCATAGCCAGGAAACGT
edem-1-mouse GGAGTCCCATTCTACAACC GCAATCCGAAAGCCACCA
gapdh-mouse AACGACCCCTTCATTGAC TCCACGACATACTCAGCAC