Skip to main content

Table 1 The primers used in real-time PCR

From: Analyses of gene expression profiles in the rat dorsal horn of the spinal cord using RNA sequencing in chronic constriction injury rats

Primers Forward Reverse Amplicon size (bp)
Cxcl13 GGCCACGGTATTCTGGAGAC CCATCTGGCAGTAGGATTCACA 192
Reg3b GTCCTGGATGCTGCTCTCCT GGCAACTAATGCGTGCAGAG 92
Plac8 AGGCAGCAACAGTTATCGTGAC CTCATCGCCACCGTTGTTCC 196
C1qc GTCAAGTTCAATTCCGCCATCAC TGTGGTGGACGAAGTAGTAGAGG 103
Ccl2 CCTGCTGCTACTCATTCACTGG TTCTGATCTCACTTGGTTCTGGTC 197
C1qa TGTCTGTCTATCGTGTCCTCCTC GATGCTGTCGGCTTCAGTACC 192
C3 TGTGAGCCTGGAGTGGACTAC CTGAGCCTGACTTGATGACCTG 112
C1qb AGGTGGCTCTGGAGACTACAAG GAACTGGCGTGGTAGGTGAAG 198
C4a CCAGACTCACATCTCCATCTCAAG CCTCCAGGTCTCCGATCTCAG 80
Ngfr CCTGCCTGGACAGTGTTACATTCTC CAGTCTCCTCGTCCTGGTAGTAGC 132
Aif1 CCAACAGGAAGAGAGGTTGGA CAGCATTCGCTTCAAGGACA 169
Urgcp ACGTCAGCAGCAACTCCAAG GGATTCGTGCCTAAGTTGAGGT 106
Dusp1 AGATATGCTCGACGCCTTGG TGTCTGCCTTGTGGTTGTCC 122
β-actin TGTCACCAACTGGGACGATA GGGGTGTTGAAGGTCTCAAA 165