Skip to main content

Table 2 Primers for PCR

From: α1-antitrypsin mitigates NLRP3-inflammasome activation in amyloid β1–42-stimulated murine astrocytes

Primer Sequence Bp AT
ASC Forward: CTTGTCAGGGGATGAACTCAAAA
Reverse: GCCATACGACTCCAGATAGTAGC
154 60
Casp1 Forward: CCGTGGAGAGAAACAAGGAGT
Reverse: CCCCTGACAGGATGTCTCCA
180 62
GAPDH Forward: TGTGTCCGTCGTGGATCTGA
Reverse: CCTGCTTCACCACCTTCTTGA
77 65
HPRT Forward: GCTGGTGAAAAGGACCTCT
Reverse: CACAGGACTAGAACACCTGC
249 61
Hsp90 Forward: TACTACTACTCGGCTTTCCCGT
Reverse: TCGAATCTTGTCCAGGGCATC
192 64
IL-1β Forward: CAGCTCATATGGGTCCGACA
Reverse: CTGTGTCTTTCCCGTGGACC
251 61
IL-18 Forward: SGCCTGTGTTCGAGGATATGACT
Reverse: CCTTCACAGAGAGGGTCACAG
122 62
NLRP3 Forward: CCTGGGGGACTTTGGAATCA
Reverse: GATCCTGACAACACGCGGA
113 65
  1. List of primers, respective sequences, base pairs (bp) and annealing temperature in °C (AT) used for sq-PCR and q-RT-PCR