Skip to main content

Table 1 Primer table. Primer sequences of measured genes in qPCR experiments

From: Glial-neuronal signaling mechanisms underlying the neuroinflammatory effects of manganese

Gene Accession no. Primer sequence (5′–3′) Length (bp)
Nos2 NM_010927.3 For: TCA CGC TTG GGT CTT GTT 149
Rev: CAG GTC ACT TTG GTA GGA TTT
Tnfα NM_013693.3 For: CTT GCC TGA TTC TTG CTT CTG 140
Rev: GCC ACC ACT TGC TCC TAC
Il1-β NM_008361.3 For: GCA GCA GCA CAT CAA CAA G 90
Rev: CAC GGG AAA GAC ACA GGT AG
Ccl2 NM_011331.2 For: TTAAAAACCTGGATCGGAACCAA 121
Rev: GCATTAGCTTCAGATTTACGGGT
Ccl5 NM_013653.3 For: GCT GCT TTG CCT ACC TCT CC 104
Rev: TCG AGT GAC AAA CAC GAC TGC
Il-6 NM_031168.1 For:CTG CAA GAG ACT TCC ATC CAG 131
Rev:AGT GGT ATA GAC AGG TCT GTT GG
β-actin NM_007393.3 For: GCT GTG CTA TGT TGC TCT AG 117
Rev: CGC TCG TTG CCA ATA GTG
Hprt NM_013556.2 For: TCA GTC AAC GGG GGA CAT AAA 142
Rev: GGG GCT GTA CTG CTT AAC CAG
C3 NM_009778.3 For: GAG CGA AGA GAC CAT CGT ACT 83
Rev: TCT TTA GGA AGT CTT GCA CAG TG
Ccr2 XM_011243064.2 For: ATC CAC GGC ATA CTA TCA ACA TC 89
Rev: TCG TAG TCA TAC GGT GTG GTG
  1. List of qPCR primer sequences