Skip to main content

Table 1 List of primers used in quantitative RT-PCR analysis, antibodies and lectins used in the experiments and their working dilutions

From: Persistent reduction in sialylation of cerebral glycoproteins following postnatal inflammatory exposure

Gene Forward (5′ to 3′) Reverse (5′ to 3′) Reference
Gapdh AAGGTCGGTGTGAACGGATT TGAACTTGCCGTGGGTAGAG [63]
Neu1 GTAGCACGTGGTCCTCTACG ATCGTGATCGTGTTTGGGCT Primer Blast
Neu3 CTCAGTCAGAGATGAGGATGCT GTGAGACATAGTAGGCATAGGC [64]
Neu4 CCGGACTGTGGTTGGTAGAC ACCAGGGAGCGTAAAGCAAT Primer Blast
Antibody/lectin Working dilution Catalog number, company
 Anti GFAP (GA5), mouse mAb 1:300 3670, Cell Signaling Technology
 Anti-PSA, mouse mAb 1:600 [65]
 Anti-NeuN, mouse mAb 1:200 MAB377, EMD Millipore Corporation
 Anti-NeuN, guinea pig polyclonal 1:300 ABN90P. EMD Millipore Corporation
 Anti-LAMP1 antibody—lysosome marker 1:1500 ab24170, Abcam
 Goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor 488 1:1500 A-11034, Thermo Fisher Scientific
 Goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 555 1:1500 A-21422, Thermo Fisher Scientific
 Goat anti-mouse IgG (H+L), cross-adsorbed secondary antibody, Alexa Fluor 488 1:500 A11001, Invitrogen
 Donkey anti-guinea pig IgG antibody, Cy3 conjugate 555 1:750 AP193C, EMD Millipore Corporation
 Isolectin GS-IB4 from Griffonia simplicifolia, Alexa Fluor® 568 conjugate 1:200 I21412, Thermo Fisher Scientific
 Biotinylated peanut agglutinin lectin 1:10,000 B-1075, Vector Laboratories
 Biotinylated Maackia amurensis lectin II 1:20,000 B-1265, Vector Laboratories
 Streptavidin-horseradish peroxidase conjugate 1:1000 RPN1231-100UL, GE Healthcare Life Sciences