Skip to main content

Advertisement

Table 2 Primer sequences used to study gene expression

From: Counteracting neuroinflammation in experimental Parkinson’s disease favors recovery of function: effects of Er-NPCs administration

m 18S F: AACTTTCGATGGTAGTCGCCGT
R: TCCTTGGATGTGGTAGCCGTTT
m IL1-alpha F: ATGGCCAAAGTTCCTGACTTGTTTGAAGAC
R: GTTGCTTGACGTTGCTGATACTGTCACCCG
m IL1-beta F: GGCAACTGTTCCTGAACTCAACTGTGAAAT
R: CAGGTAGCTGCCACAGCTTCTCCACAGCCA
m IL-6 F: TCCAGTTGCCTTCTTGGGACTGATGCTGGT
R: AGTTTCAGATTGTTTTCTGCAAGTGCATCA
m IL-10 F: CCTGGCTCAGCACTGCTATGCTGCCTGCTC
R: AAGTAACCCTTAAAGTCCTGCATTAAGGAG
m TNF F: GACGTGGAACTGGCAGAAGAGGCACTCCC
R: GAGGCCATTTGGGAACTTCTCATCCCTTTG
h IL1-beta F: ACAGATGAAGTGCTCCTTCCA
  R: GTCGGAGATTCGTAGCTGGAT
h TNF F: CACTGAAAGCATGATCCGGGACGTGGAGCT
R: TCTTCCCTCTGGGGGCCGATCACTCCAAAG
h 18S F: GCTTAATTTGACTCAACACGGGA
R: AGCTATCAATCTGTCAATCCTGTC
  1. m mouse, h human