Skip to main content

Table 1 Quantitative real time PCR primers

From: Sequential alteration of microglia and astrocytes in the rat thalamus following spinal nerve ligation

Gene name Primer name GenBank ID Forward primer sequence Reverse primer sequence
Glial fibrillary acidic protein Gfap NM_017009 GGTGTGGAGTGCCTTCGTATTAG GGGACACTTTCAGCTCCATTTCT
S100 calcium binding protein, beta polypeptide S100b NM_013191 GAGGAATGAAGGGCCACTGA CCCTAGGCACCAGCAGGTC
Glutamine synthetase GS NM_017073 ATTCCACGAAACCTCCAACATC TCTCCTGGCCGACAATCC
Cluster of differentiation 11b/integrin alpha M CD11b/Itgam NM_012711 TGAAGGCTCAGACAGAGACCAAA GCTGCCCACAATGAGTGGTAC
Ionized binding adaptor molecule 1 Iba-1 NM_017196 CAACAAGCACTTCCTCGATGATC TGAAGGCCTCCAGTTTGGACT
Toll-like receptor 4 Tlr4 NM_019178 AGCAATGTGATGAAACCCCATAC GATTCTTTGCCTGAGTTGCTTAATT
Cathepsin S Ctss NM_017320 GTGGTTGGCTATGGGACTCTTG CCAAAGTGAAGGCCCCAACT
Chemokine (C-X3-C motif) ligand 1/fractalkine Cx3cl1 NM_134455 CAGCCAGTGACTCACTCCTTGA CTGGCTTCCTCACTCTGGGA
Chemokine (C-X3-C motif) receptor 1/fractalkine receptor Cx3cr1 NM_133534 GAACCGGAAGAAGGCCAGAG GCGTCCAGAAGAGGAAGAAGAC
β actin Actb NM_031144 CGGCAATGAGCGGTTCC TGCCACAGGATTCCATACCC
Peptidylprolylisomerase A Ppia NM_017101 ACCCCATCTGCTCGCAATAC GGAATGAGGAAAATATGGAACCC
Succinate dehydrogenase complex, subunit A Sdha NM_130428 TGCGGAAGCACGGAAGGAGT CTTCTGCTGGCCCTCGATGG
Valosin-containing protein Vcp NM_053864 GAGGTTTTGGCAGCTTCAGATT ACCTCCACTGCCCTGACTTG