Skip to main content

Advertisement

Table 1 Real-time PCR primers used for quantification of mRNA expression in this study

From: Mesenchymal stem cells alleviate the early brain injury of subarachnoid hemorrhage partly by suppression of Notch1-dependent neuroinflammation: involvement of Botch

Primer name Sequence (5′ → 3′)
Notch1 Forward GTGTGTGAAAAGCCCGTGTC
Reverse GCACAAGGTTCTGGCAGTTG
RBP-Jκ Forward CACGTTCCATGAGGGAGTGG
Reverse TGGCATTTGTGTAATTTCCTTTGC
Hes-1 Forward GCTGCTACCCCAGCCAGTG
Reverse GCCTCTTCTCCATGATAGGCTTTG
Botch Forward TGGATTTTCGGGTACGGCTC
Reverse GTCTGCCAAACGCAACAAGT
β-actin Forward TCAGCAAGCAGGAGTACGATG
Reverse GTGTAAAACGCAGCTCAGTAACA