Skip to main content

Table 1 Primer sequences used for RT-PCR analysis

From: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway

Gene Primer
Forward Reverse
TNF-α ATCCGCGACGTGGAACTG ACCGCCTGGAGTTCTGGAA
IL-1β GAGCACCTTCTTTTCCTTCATCTT TCACACACCAGCAGGTTATCATC
IL-6 CAACGATGATGCACTTGCAGA CTCCAGGTAGCTATGGTACTCCAGA
iNOS TAGGCAGAGATTGGAGGCCTTG GGGTTGTTGCTGAACTTCCAGTC
CD16 GCCAATGGCTACTTCCACCAC GTCCAGTTTCACCACAGCCTTC
CD32 CCAGAAAGGCCAGGATCTAGTG GGGAACCAATCTCGTAGTGTCTGT
NR2B AGAACTTGGACGCTGTATTGGAGA TGCAACAGCCAAAGCTGGA
Ptk2 AGAACTTGGACGCTGTATTGGAGA TGCAACAGCCAAAGCTGGA
Ptger3 TGTGTGCTGTCCGTCTGTTG CTTCTCCTTTCCCATCTGTGTCTT
Slamf8 GTGCCAATTACACTGTTCCTGATCC GTCCAAGCACCAGTTTATGTTGTCC
Pex5l CCAACACTTTCATATCCGTTGCTC CTGCCTCTGGCATGGTTTCA
HPSE ACAAACGGAGTTGTTGAAGTGAGG AGCACTACAGACATCGGGACAGAG
β-actin TCATCACTATTGGCAACGACG AACAGTCCGCCTAGAAGCAC