Skip to main content

Table 1 Primers used for qRT-PCR

From: More than just inflammation: Ureaplasma species induce apoptosis in human brain microvascular endothelial cells

Gene symbol Sequence accession no. Orientation Sequence [5′ to 3′] Amplicon length [bp]
CASP1 NM_033292.3 Forward AAGTCGGCAGAGATTTATCC 115
Reverse ATGTCAACCTCAGCTCCAG
CASP3 NM_004346.3 Forward CATTGAGACAGACAGTGG 108
Reverse TCGCCAAGAATAATAACCAG
CASP4 NM_001225.3 Forward GTTTGACCATCTGCCTCC 126
Reverse CGCTGACTCCATATCCCT
CASP5 NM_004347.3 Forward CTTTCTGTTCTTCAACACCA 143
Reverse ATGATTTCTGTACCTTCCGA
CASP8 NM_001228.4 Forward CTGATTCAGAGGAGCAACCC 200
Reverse GAATATCATCGCCTCGAGGAC
CASP9 NM_001229.4 Forward CCATATCTAGTTTGCCCACAC 183
Reverse GAAACAGCATTAGCGACCCT
HPRT1 NM_000194.2 Forward CTGGCGTCGTGATTAGTG 121
Reverse AGTCCTGTCCATAATTAGTCC