Skip to main content

Advertisement

Table 1 PCR primer sequences utilized

From: Murine astrocytes produce IL-24 and are susceptible to the immunosuppressive effects of this cytokine

mRNA Forward primer (5′-3′) Reverse primer (5′-3′)
IL-24 CTGGACTGTGAAGAACACTGTGCA GTCCAGCCCAAAGGCTTTCAC
IL-22Rα TGACTGATCGTTTCAGCTCGCTGC GGAGTCAGGCCAAGGAACTCGTAT
COX2 TCAGCCAGGCAGCAAATCCTTG TAGTCTCTCCTATGAGTATGAGTC
GLT-1 CAAGTCTGAGCTGGACACCA GGCTGAGAATCGGGTCATTA
SOCS3 TTTCGCTTCGGGACTAGC CGCTCAACGTGAAGAAGTG
GAPDH CCATCACCATCTTCCAGGAGCGAG CACAGTCTTCTGGGTGGCAGTGAT