Skip to main content

Table 1 Primer sequences utilized for RT-qPCR analysis

From: Augmented β2-adrenergic signaling dampens the neuroinflammatory response following ischemic stroke and increases stroke size

Gene GenBank accession number Gene name Primer sequence (5′-3′)
Adrb2 NM_007420.3 Adrenergic receptor beta-2 Forward: TCGAGCGACTACAAACCGTC
Reverse: CCAGAACTCGCACCAGAAGT
TNFα NM_013693.3 Tumor necrosis factor-alpha Forward: TAGCCCACGTCGTAGCAAAC
Reverse: GTCTTTGAGATCCATGCCGTTG
iNOS NM_001313922.1 Inducible nitric oxide synthase Forward: TGACGGCAAACATGACTTCAG
Reverse: GCCATCGGGCATCTGGTA
IL-10 NM_010548.2 Interleukin 10 Forward: CTGGACAACATACTGCTAACCG
Reverse: GGGCATCACTTCTACCAGGTAA
Ym1 NM_009892.3 Chitinase-like 3 Forward: AGACTTGCGTGACTATGAAGCATT
Reverse: GCAGGTCCAAACTTCCATCCTC
Mki67 NM_001081117.2 Marker of proliferation Ki-67 Forward: ATCATTGACCGCTCCTTTAGGT
Reverse: GCTCGCCTTGATGGTTCCT
Gapdh NM_001289726.1 Glyceraldehyde-3-phosphate dehydrogenase Forward: ATCATTGACCGCTCCTTTAGGT
Reverse: GCTCGCCTTGATGGTTCCT