Skip to main content

Table 2 Primer sequences used for reverse transcription

From: A co-ultramicronized palmitoylethanolamide/luteolin composite mitigates clinical score and disease-relevant molecular markers in a mouse model of experimental autoimmune encephalomyelitis

Gene Forward (5′ → 3′) Reverse (5′ → 3′)
GAPDH TGGTGAAGGTCGGTGTGAAC AATGAAGGGGTCGTTGATGG
SAA1 ACACTGACATGAAGGAAGCTAAC GACCCCTTTGAGCAGCATCAT
TNF-α CAAGTGGAGGAGCAGCTGGA CATCGGCTGGCACCACTAGT
IL-1β CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT
IFN-γ ACATGAAAATCCTGCAGAGCCA TCAGGTGTGATTCAATGACGCT
NLRP3 CCTGACCCAAACCCACCAGT AGACCTCCCCAATGTGCTCG
TLR2 GCGGTCACTGGCAGGAGA CATCTTTTCCACTTCTAGGTCGC
Fpr2 TCCTGGGCTCAAACTGATGA GCAACAATTGACATGGGCAT
CD137 TCTGTGCTTAAGACCGGGACC ATGGTGGTACTGGGAGAGAAGC
CD3γ AGTGGCTTAAAGACGGGAGC CCTCGAGGGTCTTTGGCATTG
TCR ζ chain GAGCTTTGGTCTGCTGGATCCC ACAGGGCTGTGATGATGACTCC
CB1 GATCTTAGACGGCCTTGCAGA AATGTCATTTGAGCCCACGTAG
CB2 ACAGCTCCAGTAGAAGAAGCCA TGAACTCCAAGCCACCGTTG
MBP TCCGAGGAGAGTGTGGGTTT TGGAACGATCTGGAGGGTTT