Skip to main content

Advertisement

Table 1 RNA primers used for qPCR

From: A small peptide antagonist of the Fas receptor inhibits neuroinflammation and prevents axon degeneration and retinal ganglion cell death in an inducible mouse model of glaucoma

Primers Forward sequence (5′-3′) Reverse sequence (5′-3′)
B2Micr ACGTAACACAGTTCCACCCG CGGCCATACTGGCATGCTTA
Ppia GAGCTGTTTGCAGACAAAGTTC CCCTGGCACATGAATCCTGG
C1Q CAAGGACTGAAGGGCGTGAA CAAGCGTCATTGGGTTCTGC
C3 AGCAGGTCATCAAGTCAGGC GATGTAGCTGGTGTTGGGCT
Casp 8 CTCCGAAAAATGAAG GACAGA CGTGGGATAGGATACAGCAGA
GFAP CCCTGGCTCGTGTGGATTT GACCGATACCACTCCTCTGTC
IL-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG
IL-6 GTCCGGAGAGGAGACTTCAC CTGCAAGTGCATCATCGTTGT
IL-18 AGTGAACCCCAGACCAGACT TCAGGTGGATCCATTTCCTCAA
IP-10 TGAGCTAGGGAGGACAAGGA GGA TGG CTG TCC TAG CTC TG
MCP1 GGCGGTCAAAAAGTTTGCCT TTCTTCCGTTGAGGGACAGC
MIP-1α TGCCAAGTAGCCACATCGAG TGACCAACTGGGAGGGAGAT
MIP-1β GTCCTTGCTCCTCACGTTCA CCATCTCCATGGGAGACACG
MIP-2 GGCGGTCAAAAAGTTTGCCT TTCTTCCGTTGAGGGACAGC
NLRP 3 ATTACCCGCCCGAGAAAGG TCGCAGCAAAGATCCACACAG
TLR4 CTCTGGGGAGGCACATCTTC CCCAGGTGAGCTGTAGCAT
TNF-α CCTCTCATGCACCACCATCA GCATTGCACCTCAGGGAAGA