Skip to main content

Table 2 Information of qPCR primers

From: Peripheral loss of EphA4 ameliorates TBI-induced neuroinflammation and tissue damage

GenePrimer sequence (5′-3′)
β-actinFw: TCGTACCACAGGCATTGTGATGGA
Rv: TGATGTCACGCACGATTTCCCTCT
Angpt2Fw: GGAAAAGCAGATTTTGGATCAG
Rv: TTCTGCTCCTTCATGGACTGTA
Arg1Fw: AAGATAGGCCTCCCAGAACCG
Rv: AAAGGCCGATTCACCTGAGC
Ccr2Fw: GGGCTGTGAGGCTCATCTTT
Rv: TGCATGGCCTGGTCTAAGTG
GapdhFw: CGTCCCGTAGACAAAATGGT
 Rv: TCAATGAAGGGGTCGTTGAT
Il12p40Fw: AGACCCTGCCCATTGAACTG
Rv: GAAGCTGGTGCTGTAGTTCTCATATT
Il6Fw: CTTCACAAGTCGGAGGCTTAAT
Rv: GATTGTTTTCTGCAAGTGCATC
Kc (cxcl1)Fw: ACCCAAACCGAAGTCATAGCCACA
Rv: AGTGTTGTCAGAAGCCAGCGTTCA
Mcp1Fw: TCACCTGCTGCTACTCATTCACCA
Rv: TACAGCTTCTTTGGGACACCTGCT
TnfFw: AGAAGAGGCACTCCCCCAAA
Rv: TGAGGGTCTGGGCCATAGAA
Tie2Fw: AAATGACCCTAGTGAAGCCAGA
Rv: GTCAGGAGGTAAGACTCGGTTG
Epha4Fw: AAAAATGTACTGTGGGGCAGAT
Rv: TCCGTGGAAAGAGCTTTGTAAT
VcamFw: GGTGTACGAGCCATCCACAG
Rv: ACTTGTGGAAATGTGCCCGA
Gja1 (cx43)Fw: CGGAAGCACCATCTCCAACT
Rv: CCACGATAGCTAAGGGCTGG
Il6rFw: CTGTTTGCAACGCACAGTGA
Rv: AACACCACCAACGGGAAGAG
Cd86Fw: TGTGCCCAAATAGTGCTCGT
Rv: TCTGCCGTGCCCATTTACAA