Skip to main content

Table 1 qPCR primers

From: Nav1.6 promotes inflammation and neuronal degeneration in a mouse model of multiple sclerosis

Gene Primer sequence or company (catalog number)
Hprt Bio-Rad (cat. no. 10025636)
Gapdh Bio-Rad (cat. no. 10025637)
Il6 Qiagen (cat. no. PPM03015A)
Gfap Forward (5′-3′) AGGGGCAGATTTAGTCCAAC
Reverse (5′-3′) AGGGAGTGGAGGAGTCATTC
Scn8α Forward (5′-3′) GCAAGCTCAAGAAACCACCC
Reverse (5′-3′) CCGTAGATGAAAGGCAAACTCT
Rbpms Forward (5′-3′) AGAGCTGTACCTGCTCTTCAGACC
Reverse (5′-3′) GCCTCTGCTTCTGAGCGACTGTC
Ifng Bio-Rad (cat. no.10025636)