Skip to main content

Table 1 Primers used for qRT-PCR

From: Wnt canonical pathway activator TWS119 drives microglial anti-inflammatory activation and facilitates neurological recovery following experimental stroke

PrimersForward (5′–3′)Reverse (5′–3′)
TNF-αGATCTCAAAGACAACCAACTAGTGCTCCAGCTGGAAGACTCCTCCCAG
CD16TTTGGACACCCAGATGTTTCAGGTCTTCCTTGAGCACCTGGATC
IL-6AGTTGCCTTCTTGGGACTGATCCACGATTTCCCAGAGAAC
iNOSCAAGCACCTTGGAAGAGGAGAAGGCCAAACACAGCATACC
IL-1βTGTCTTGGCCGAGGACTAAGGTGGGCTGGACTGTTTCTAATGC
IL-10CCAAGCCTTATCGGAAATGATTTTCACAGGGGAGAAATCG
CD206CAAGGAAGGTTGGCATTTGTCCTTTCAGTCCTTTGCAAGC
TGF-βTGCGCTTGCAGAGATTAAAACGTCAAAAGACAGCCACTCA
Arg-1TCACCTGAGCTTTGATGTCGCTGAAAGGAGCCCTGTCTTG
YM1/2CAGGGTAATGAGTGGGTTGGCACGGCACCTCCTAAATTGT
β-cateninGCTGATTTGATGGAGTTGGAGCTACTTGTTCTTGAGTGAA
GAPDHAGGAGCGAGACCCCACTAACAAGGGGGGCTAAGCAGTTGGT
  1. Arg arginase, CD cluster of differentiation, GAPDH glyceraldehyde-3-phosphate dehydrogenase, iNOS inducible nitric oxide synthase, IL interleukin, TGF transforming growth factor, TNF tumor necrosis factor