Skip to main content

Table 2 Related to materials and methods. Mouse primers for real-time PCR

From: The potassium channel KCa3.1 represents a valid pharmacological target for microgliosis-induced neuronal impairment in a mouse model of Parkinson’s disease

Gene nameForward primerReverse primer
Mouse Tnf-αCAGGAGGGAGAACAGAAACTCCACCTGGTTGGCTGCTTGCTT
Mouse Il-1βTCCAGGATGAGGACATGAGCACGAACGTCACACACCAGCAGGTTA
Mouse iNOSTAGGCAGAGATTGGAGGCCTTGGGGTTGTTGCTGAACTTCCAGTC
Mouse Cox-2CAGGCTGAACTTCGAAACAGCTCACGAGGCCACTGATACCTA
Mouse Il-6GCCAGAGTCCTTCAGAGAGAGGTCTTGGTCCTTAGCCACT
Mouse GapdhTGTGTCCGTCGTGGATCTGAAGGGGCCATCCACAGTCTTC