Skip to main content

Table 1 Primers and parameters of RT-qPCR

From: The impact of hyperpolarization-activated cyclic nucleotide-gated (HCN) and voltage-gated potassium KCNQ/Kv7 channels on primary microglia function

RNASequences forward/reversed 5`-3`Temperature (°C) step 1/2/3Duration (s) step 1/2/3Accession number
Iba1CCAGCGTCTGAGGAGCTATG/
CGTCTTGAAGGCCTCCAGTT
95/60/7215/15/45NM_017196.3
P2RY12TTGCACGGATTCCCTACACC/
GGGTGCTCTCCTTCACGTAG
95/60/7215/15/45NM_022800.1
KCNK13GAGAACGAAGGGCTCTACCG/
GAAGCACCCGCTATCCAGTT
95/60/7215/15/45NM_022293.1
HCN1CAGAGCACTTCGGATCGTGA/
GGAGCAGCATCATGCCAATG
95/59.8/7215/15/45NM_053375.1
HCN2 N° 1AGATCATCCTGGACCCCGAA/
GGATCTTGGTGAAACGCACG
95/59.8/7215/15/45NM_053684.1
HCN2 N° 2ACCGGCATTGTTATTGAGGAC/
CCTCGGAGTCGATTCCCTTC
95/59.8/7215/15/45NM_053684.1
HCN3GTGCAGTGGTTCGCATCTTC/
GGGAAGTCCTGCAGCATAGG
95/59.8/7215/15/45NM_053685
HCN4CGGTCACCATCATCTAGCCC/
TGCCATAAAGGATGGCCGTT
95/59.8/7215/15/45NM_021658
KCNQ1GTGGTCCAACCTGCAACAAC/
CTTCATCAGGGCCTGTCTGG
95/59.0/7215/15/45NM_032073.1
KCNQ2CGTGGTATTCGGTGTTGAGT/
CTCCGAAGTGCAGACGTAG
95/57.8/7215/15/45NM_133322.1
KCNQ3TCATGTCCGTCAACCACGAG/
ACCGCTTTTCCCTCATCCAG
95/59.0/7215/15/45NM_031597
KCNQ4AATCCGCATAAGCATCTCCCA/
GAAGCTCCAGCTTTTCTGCAC
95/59.0/7215/15/45AF249748.1
KCNQ5AAGACGGGAGACAGTACGGA/
TTCCTGACTCTTGCGCGATT
95/58.0/7215/15/45NM_001134643
iNOSGCTTGTCTCTGGGTCCTCTG/
CTCACTGGGACAGCACAGAA
95/59.0/7215/15/45NM_012611.3
CD206AACAAGAATGGTGGGCAGTC/
CCTTTCAGTCCTTTGCAAGC
95/56.0/7215/15/45NM_001106123.2
Ki67TCTTGGCACTCACAGTCCAG/
GCTGGAAGCAAGTGAAGTCC
95/58.0/7215/15/45NM_001271366.1
RPL13aTCTCCGAAAGCGGATGAACA/
CAACACCTTGAGGCGTTCCA
 15/15/45NM_173340.2
Small interfering RNA HCN2GCACCGGCAUUGUUAUUGAtt
UCAAUAACAAUGCCGGUGCga