Skip to main content

Table 1 Primers used in qPCR analysis

From: Maternal high-fat diet induces sex-specific changes to glucocorticoid and inflammatory signaling in response to corticosterone and lipopolysaccharide challenge in adult rat offspring

Primer Sequence
Reference genes
β-Actin FW: TTTGAGACCTTCAACACCCC
RV: ATAGCTCTTCTCCAGGGAGG
GAPDH FW: ACATCAAATGGGGTGATGCT
RV: GTGGTTCACACCCATCACAA
18S rRNA FW: ATGGTAGTCGCCGTGCCTA
RV: CTGCTGCCTTCCTTGGATG
YWHAZ FW: TTGAGCAGAAGACGGAAGGT
RV: GAAGCATTGGGGATCAAGAA
Target genes
GR RT2 qPCR Primer Assay (PPR52805B, Qiagen)
MR FW: GGCAGCTGCAAAGTCTTCTT
RV: GACAGTTCTTTCGCCGAATC
NFκB RT2 qPCR Primer Assay (PPR42746A, Qiagen)
IκBα FW: CAGGATTCTGCAGGTCCACT
RV: TGGAGCACTTGGTGACTTTG
IL6 RT2 qPCR Primer Assay (PPR06483B, Qiagen)
IL10 RT2 qPCR Primer Assay (PPR06479A, Qiagen)
CD11B FW: GAAGCCTTGGCGTGTGATAG
RV: GAGCAGTTTGTTCCCAAGGG
MKP1 FW: GCTCCACTCAAGTCTTCTTCCTCCAA
RV: TGGACTGTTTGCTGCACAGCTCAG
IGF1 FW: GCTCTTCAGTTCGTGTGTGG
RV: TGAGTCTTGGGCATGTCAGT