Skip to main content

Table 1 Primers for measurements of mRNA levels using qRT-PCR

From: CCL2/CCR2 system in neuroepithelial radial glia progenitor cells: involvement in stimulatory, sexually dimorphic effects of maternal ethanol on embryonic development of hypothalamic peptide neurons

Gene GenBank accession Forward 5′-3′ Reverse 5′-3′ Concentration (nM)
Cyclophilin NM_001004279 TGTGCTGAATATTGGTGCTTGTAA TGTGCTGAATATTGGTGCTTGTAA 200
BLBP NM_030832 TGATTCGGTTGGATGGAGACA CGACATCCCCAAAGGTGAGA 200
CCL2 NM_031530 GTG CTG TCT CAG CCA GAT GCA GTT AGT TCT CCA GCC GAC TCA TTG GG 200
CCR2 NM_021866 TAC CTG TTC AAC CTG GCC ATC T AGA CCC ACT CAT TTG CAG CAT 200
MCH M_029712 CAAACAGGATGGCGAAGATGA AGGCTTTCCCCATCCTGAAT 50
  1. BLBP brain lipid-binding protein, CCL2 C-C motif ligand 2, CCR2 receptor for CCL2, MCH melanin-concentrating hormone