Skip to main content

Table 1 Sequences of mouse primers used for real time-PCR

From: Lipocalin 2 induces neuroinflammation and blood-brain barrier dysfunction through liver-brain axis in murine model of nonalcoholic steatohepatitis

Gene name Primer sequence (5′----3′)
IL-1r Forward: GAATGACCCTGGCTTGTGTT
Reverse: TGTGCTCTTCAGCCACATTC
TLR4 Forward: GGAGTGCCCCGCTTTCACCTC
Reverse: ACCTTCCGGCTCTTGTGGAAGC
BDNF Forward: TGCAGGGGCATAGACAAAAGG
Reverse: CTTATGAATCGCCAGCCAATTCTC
RAGE Forward: CCAATGGTTCCCTCCTCCTT
Reverse: TAAGTGCCAGCTAAGGGTCC
TNFαR Forward: GCTGTTGCCCCTGGTTATCT
Reverse: ATGGAGTAGACTTCGGGCCT
p47phox Forward: GGTCGACCATCCGCAACGCA
Reverse: TGTGCCATCCGTGCTCAGCG
24p3R Forward: TACCTGATGCGCCTGGAGCT
Reverse: TTCTCCAGTTCCTGCAAAGCTT
Caspase1 Forward: TGGTCTTGTGACTTGGAGGA
Reverse: TGGCTTCTTATTGGCACGAT
IL-18 Forward: AGCAGTGGTTTTCAGCTGGG
Reverse: CACACCACAGGGGAGAAGTG
18S Forward: TTCGAACGTCTGCCCTATCAA
Reverse: ATGGTAGGCACGGCGACTA
\