Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: Coding transcriptome analyses reveal altered functions underlying immunotolerance of PEG-fused rat sciatic nerve allografts

Gene transcript Accession number Forward primer (5′-3′) Reverse primer (5′-3′)
Shh NM_017221.1 CTGGATTCGACTGGGTCTACTA GGAAGCAGCCGTCAGATTT
Spp1 NM_012881.2 CACCAAGGACCAACTACAA TGCCAAACTCAGCCACTT
Sox8 NM_001106989.1 CCCATGGTGAAAGCATGAAAG TGGGAAAGACCTGTGGTAATG
Fbln5 NM_019153.3 CCTACTCCAATCCCTACTCTACA TACCCAAAGCGACAGACAAG
Cd24 NM_012752.3 CTTGCCCATTCTGGGATCTAAT GTTCCCGGGTAGGTTTCTAAAG
Ngfr NM_012610.2 TCTGGCCAAAGAAGAGGATTAC CATCCTGTGTGTGAGAGAGAAG
Col8a1 NM_001107100.1 CTCTACAGCTGCTGGGAATAC GTGGTATCTGAGGAGGGATTTG
Ctsd NM_134334.2 CACATCCTTCGACATCCACTAC TCCACCTTGATACCTCCTAAGT
Thbs1 NM_001013062.1 ACTGAGAGGATGACGACTATG GTAGGACTGGGTGACTTGTTTC
Thbs2 NM_001169138.1 CCCAGAGGCAGTTTGAGATT CATCCTCCAGGAAGTTGGTATG
Icam1 NM_012967.1 GTATCCATCCATCCCACAGAAG CAGTTGTGTCCACTCGATAGTT
Ccr5 NM_053960.3 GCTAGGCAGAGGAGAATGTTAG TGTCTCCTCCTCCCAGTAAA
Ccl5 NM_031116.3 CAGAGAAGAAGTGGGTTCAAGA GAGCAAGCAATGACAGGAAAG
Irf1 NM_012591.1 CTCACCAAGAACCAGAGGAAAG AGATAAGGTGTCAGGGCTAGAA
Gzmb NM_138517.3 AACCAGGAGATGTGTGCTATG CCTCTTGTAGTGTGTCTGAGTATTT
Faslg NM_012908.1 GGTGCTAATGGAGGAGAAGAAG TAAATGGTCAGCAACGGTAAGA
Il10 NM_012854.2 AGTGGAGCAGGTGAAGAATG GAGTGTCACGTAGGCTTCTATG
Nos2 NM_012611.3 TGGAGCGAGTTGTGGATTG CCTCTTGTCTTTGACCCAGTAG
Cxcl11 NM_182952.2 GTGCCCTGCAAACATTTCTAC GTGGGAAGCCAGTGTGATTA
Ifng NM_138880.2 CGAATCGCACCTGATCACTAA TGGATCTGTGGGTTGTTCAC