Skip to main content

Table 3 List of primers used for RT-PCR on mRNAs

From: Decreased expression of miR-29 family associated with autoimmune myasthenia gravis

  Gene name Sens primer Antisens primer
Human primers 28S GGTAGGGACAGTGGGAATCT CGGGTAAACGGCGGGAGTAA
CD19 TACTATGGCACTGGCTGCTG CACGTTCCCGTACTGGTTCT
DICER TGCTGAAACTGCAACTGACC CAGGGTCCCAGAACTACCAA
GAPDH CGACCACTTTGTCAAGCTCA AGGGGTCTACATGGCAACTG
IFNAR1 CCTCCTGTGAGCCTAAGTGC AAGGGCCTACCCTCAGTGTT
Mouse primers Baff TTCCATGGCTTCTCAGCTTT GGAATTGTTGGGCAGTGTTT
Ccl21 CCCTGGACCCAAGGCAGT AGGCTTAGAGTGCTTCCGGG
Cd19 CCCTCACCTTCGAGTTTCTG TAGGTTCACAGGTCCCAAGG
Cxcl13 TGAGGCTCAGCACAGCAA ATGGGCTTCCAGAATACCG
Cxcr5 ATGGCCTTAATGTGCCTGTC CTTCTGGAACTTGCCCTCAG
Gapdh AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA
Ifn-β CCCTATGGAGATGACGGAGA CTGTCTGCTGGTGGAGTTCA
Ifn-α2 TCTGTGCTTTCCTCGTGATG TTGAGCCTTCTGGATCTGCT
Ifnar1 CAAGTGTGCCTGGCTTGTTC AGAGAAGTCCGAGGCCATCT
Ifnar2 ACATGGGTCCTGGCTCAAAG GGCAGAGAAAGGGTTGCTCT
Ifn-γ CAGCAACAGCAAGGCGAAA GCTGGATTCCGGCAACAG
Il-4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT
lL-6 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC
Il-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG
Il-17a TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC
Il-21 GGACCCTTGTCTGTCTGGTAG TGTGGAGCTGATAGAAGTTCAGG
Il-23 CCGTTCCAAGATCCTTCGAA GACCCGGGCTGCTATGG
Tgf-β1 CAAGGGCTACCATGCCAACT CCGGGTTGTGTTGGTTGTAGA