Skip to main content

Table 2 Real-time PCR primers

From: Chronic alcohol-induced neuroinflammation involves CCR2/5-dependent peripheral macrophage infiltration and microglia alterations

  Forward Reverse
Nanostring hits
C1qa CAAGGACTGAAGGGCGTGAA GGGGCTGGTCCCTGATATTG
C1qb GGTGCCAACAGCATCTTCAC TTTGACCCCGTGATTACGCA
Daxx CTATAGGCCAGGCGTTGACC GTTCGATTTTCCCGAAGGCG
Gnas ATGGGTTTAACGGAGAGGGC ACCATCGCTGTTGCTCCTTG
Hmgn1 CTCCTCGGTGACAGATCCGA AACCTTCCTCTTGGGCATCG
Hspb1 CTGGCAAGCACGAAGAAAGG GCACCGAGAGATGTAGCCAT
Il-23 TGGTTGTGACCCACAAGGAC CAGACCTTGGCGGATCCTTT
Map3k9 TGGGCAGAAAGAGCTCACAT ACATCATCTGCCTCTTACCCTTC
Mapk1 CAGTTTGTCCCCTTCCATTGAT ACTCCCACAATGCACACGAC
Mef2a AGCACTTTGAAAGGAAGAGTCCA AGCTCCCCCACTGCACATTA
Myd88 AGGCATCACCACCCTTGATG CGAAAAGTTCCGGCGTTTGT
Plcb1 AGATCCTCGATGAGAAGCCC CTTCCGACAAGACTGAGGAGG
Tgfβ1 GTCACTGGAGTTGTACGGCA AGCCCTGTATTCCGTCTCCT
Itgb2 TTCCTGGTGCCAGAAGCTGAA CCCCGTTGGTCGAACTCAG
Ccl11 TGCAGGCAGTTTTCTCTGGA AGGCTCTCCCGACTAGCTTT
Proinflammatory
Tnfα GAAGTTCCCAAATGGCCTCC GTGAGGGTCTGGGCCATAGA
Tlr4 TCAGAACTTCAGTGGCTGGA AGAGGTGGTGTAAGCCATGC
Cox2 AACCGAGTCGTTCTGCCAAT CTAGGGAGGGGACTGCTCAT
Ym1 CAGAAGCTCTCCAGAAGCAAT TGCCAGACCTGTGACAAGAAT
Il-1β TCTTTGAAGTTGACGGACCC TGAGTGATACTGCCTGCCTG
   Il-17 CAGGGAGAGCTTCATCTGTGT GCTGAGCTTTGAGGGATGAT
CCR2/5 network
Ccl2 CCACAACCACCTCAAGCACT AGGCATCACAGTCCGAGTCA
Ccl3 ATATGGAGCTGACACCCCGA TCAACGATGAATTGGCGTGG
Ccr2 GTGTACATAGCAACAAGCCTCAAAG CCCCCACATAGGGATCATGA
Ccr5 TGGGGTGGAGGAGCAGGGAG TAGGCCACAGCATCGGCCCT
Housekeeping
Gapdh GGCAAATTCAACGGCACAGT GATGGGCTTCCCGTTGATGA
18S rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG