Skip to main content

Table 1 PCR primer sequences

From: Inhibiting HMGB1-RAGE axis prevents pro-inflammatory macrophages/microglia polarization and affords neuroprotection after spinal cord injury

Gene Forward primer(5’-3’) Reverse primer (5’-3’)
HMGB1 GCCCATTTTGGGTCACATGG TGCAGGGTGTGTGGACAAAA
iNOS AGAGACGCTTCTGAGGTTCC CTGCACCAACTCTGCTGTTC
IL-4 TCCACGGATGTAACGACAGC TGGTGTTCCTTGTTGCCGTA
IL-10 CCTCTGGATACAGCTGCGAC GTAGATGCCGGGTGGTTCAA
IL-12 ATCATCAAACCGGACCCACC CAGGAGTCAGGGTACTCCCA
IL-18 ACCGCAGTAATACGGAGCAT TCTGGGATTCGTTGGCTGTT
CD86 CGTCAAGACATGTGTAACCTGC ACCGACTTTTTCCGGTCCTG
CD206 TCAACTCTTGGACTCACGGC CATGATCTGCGACTCCGACA
TNFα ACTGAACTTCGGGGTGATCG TGGTGGTTTGCTACGACGTG
Arginase1 ACAAGACAGGGCTACTTTCAGG ACAAGACAAGGTCAACGCCA
Ym1 AGTTTGGATCTGCCCCGTTC TTAGGAGGGCTTCCACGAGA
GAPDH AGTGCCAGCCTCGTCTCATA GGTAACCAGGCGTCCGATAC