Skip to main content

Table 2 Gene sequences for qPCR

From: Macrophage to myofibroblast transition contributes to subretinal fibrosis secondary to neovascular age-related macular degeneration

Gene Forward sequence Reverse sequence
GAPDH TGGCAAAGTGGAGATTGTTGC AAGATGGTGATGGGCTTCCCG
α-SMA TGGCACCACTCTTTCTATAACG GGTCATTTTCTCCCGGTTGG
Fibronectin CCACTTCCCCTTCCTGTACA ATCGTAGTTCTGGGTGGTGC
Collagen-1 GTGGCGGTTATGACTTCAGC GGCTGCGGATGTTCTCAATC
C3 ACCTTACCTCGGCAAGTTTCT CTGCTGGTCAGGCTCCTC