Skip to main content

Table 1 Primers sequences used for RT-PCR

From: ADAMTS13 ameliorates inflammatory responses in experimental autoimmune encephalomyelitis

GenePrimer sequence (5′ to 3′) 
 ForwardReverse
β-actinGAGACCTTCAACACCCCAGCATGTCACGCACGATTTCCC
Cxcl1CACAGGGGCGCCTATCGCCAACAAGGCAAGCCTCGCGACCAT
Ccl2CCTGCTGTTCACAGTTGCCATTGGGATCATCTTGCTGGT
IL-1βGCTTCAGGCAGGCAGTATCATGCAGTTGTCTAATGGGAACG
VWFCAGACAGACGCCATCTCCAGTGCAAGCTGTAGGCAAGCAT