Skip to main content

Table 1 Primer sequence for RT-qPCR

From: Bone mesenchymal stem cell-derived exosomal microRNA-29b-3p prevents hypoxic-ischemic injury in rat brain by activating the PTEN-mediated Akt signaling pathway

miRNA/mRNA Sequence (5′-3′)
miR-29b-3p F: TTCCTATGCATATACTTCT R: CGTATCCAGTGCGAATA
PTEN F: ATCTTGTGCTCACCCTGACA R: ACCTCTCGGGAGTACACACT
GAPDH F: CTGACATGCCGCCTGGAGA R: ATGTAGGCCATGAGGTCCAC
U6 F: ATGACGTCTGCCTTGGAGAAC R: TCAGTGTGCTACGGAGTTCAG
Bcl-2 F: AGCCCTGTGCCACCTGTGGT R: ACTGGACATCTCTGCAAAGTCGCG
Bax F: AACAACATGGAGCTGCAGAGG R: GAAGTTGCCGTCTGCAAACAT
Caspase-3 F: TACCCTGAAATGGGCTTGTGT R: GTTAACACGAGTGAGGATGTG
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR microRNA, GAPDH glyceraldehyde-3-phosphate dehydrogenase, Bcl-2 B cell leukemia 2, Bax Bcl-2 associated X, R reverse, F forward