Skip to main content

Table 2 Sequences of the primers used for qPCR validation of RNA-Seq data

From: Transcriptome profiling of long noncoding RNAs and mRNAs in spinal cord of a rat model of paclitaxel-induced peripheral neuropathy identifies potential mechanisms mediating neuroinflammation and pain

Gene name Primer sequence (5′ to 3′) Amplicon size (bp)
Beta-actin Forward: TGTCACCAACTGGGACGATA 165
Reverse: GGGGTGTTGAAGGTCTCAAA
Cxcl13 Forward: CGACTTTGAAAGGTTGCTTGTA 219
Reverse: ACACTGGATGAATAGGAAACGT
Ccl3 Forward: AGAGGCAGCGAGTACCAGTCC 184
Reverse: CATAGGAGAAGCAGCAGGCAGTC
Cxcl11 Forward: GCTGTGACAAAGTTGAAGTGAT 102
Reverse: GTATTGTCTGCATTATGAGGCG
Cd68 Forward: GCTGTGACAAAGTTGAAGTGAT 200
Reverse: GGCTGGTAGGTTGATTGTCGTCTC
Mettl14 Forward: TGAGAGGCTTAGACCGAAGTCACC 104
Reverse: GACCACGGCCAGCAGATGTTC
Pcdh18 Forward: CCAGAGTCACAACAGTCACCAGTC 109
Reverse: CTCAACAGCAGGAGTGGCATGG
Nap1l4 Forward: GGCACAGTGAGAATGAGGAGGATG 163
Reverse: ACCAGTTCGCTAAGCATGTCCAC
LOC691141 Forward: AGGCGGTCCAGCTCCTACAAG 121
Reverse: ACACCATACTGACAGCGGAAGTTG
Pdk4 Forward: GGCCACGGTCGAGCATCAAG 168
Reverse: GGCGTTGGAGCAGTGGAGTATG
Slco2a1 Forward: ATCCTATTCGCCATCGCTGTGTTC 94
Reverse: TGTCCACTCTGCCGTAGTCCAC
Fgf21 Forward: TCTCCTGCTGCCTGTCTTCCTG 129
Reverse: TCGGTGTCCTGGTCGTCATCTG
Zbtb16 Forward: CACCAGCAAGATGTTTGAGATC 239
Reverse: CTGTGTCATTGTCATCAGATGC
Slc10a6 Forward: TCCTTCTCTGCTGAGTACCTGGTC 102
Reverse: TGCCTGATATGCTGCGACAATGAG
102552154 Forward: ATCGCTAGTTATGCAGGCATGGAG 124
Reverse: CAGCCAATGAGTTGCACTTGAACC
108351753 Forward: CAGTGGTTGTGAGCTGTCTGAGG 148
Reverse: ACGCAAGCATGGTAGGTGTTGG
102546487 Forward: AGCCTCAGCCTTAAGCATGTGTTC 85
Reverse: CCTTGTCTCCTCGGTTGGATGTG
108349645 Forward: AGGAGCACGGAGATAGCAACTGG 108
Reverse: CGGTGAGTACAGTGCTTGCCATAC
108352578 Forward: CGCGAACACCGGAACTCTTAGATC 125
Reverse: TGCCACTTGTGCTCAGCTTCTTC