Skip to main content

Table 1 RT-PCR primer sequences

From: Ceria nanoparticles ameliorate white matter injury after intracerebral hemorrhage: microglia-astrocyte involvement in remyelination

ID   Primer sequence
iNOS FWD CAAGCACCTTGGAAGAGGAG
  REV AAGGCCAAACACAGCATACC
CD16 FWD TTTGGACACCCAGATGTTTCAG
  REV GTCTTCCTTGAGCACCTGGATC
IFN-γ FWD CAGCAACAGCAAGGCGAAAAAGG
  REV TTTCCGCTTCCTGAGGCTGGAT
CD206 FWD CAAGGAAGGTTGGCATTTGT
  REV CCTTTCAGTCCTTTGCAAGC
YM1/2 FWD CAGGGTAATGAGTGGGTTGG
  REV CACGGCACCTCCTAAATTGT
TGF-β FWD TGCGCTTGCAGAGATTAAAA
  REV CGTCAAAAGACAGCCACTCA
C3 FWD CCAGCTCCCCATTAGCTCTG
  REV GCACTTGCCTCTTTAGGAAGTC
Serping1 FWD ACAGCCCCCTCTGAATTCTT
  REV GGATGCTCTCCAAGTTGCTC
Amigo2 FWD GAGGCGACCATAATGTCGTT
  REV GCATCCAACAGTCCGATTCT
GAPDH FWD AAGAGGGATGCTGCCCTTAC
  REV TACGGCCAAATCCGTTCACA