Skip to main content

Table 1 RT-qPCR primer sequences

From: Pexidartinib treatment in Alexander disease model mice reduces macrophage numbers and increases glial fibrillary acidic protein levels, yet has minimal impact on other disease phenotypes

Gene Forward primer Reverse primer
Gfap ACATGCAAGAGACAGAGGAGTGGT AGTCGTTAGCTTCGTGCTTGGCTT
Il34 GACGTGGCTTTGGGAAACGAGAAT AGGCACAGCAATCCTGTAGTTGATGG
Il6a TCCTTAGCCACTCCTTCTGT AGCCAGAGTCCTTCAGAGA
Csf1a GGCATCATCCTAGTCTTGCTG ACCTGTCTGTCCTCATCCT
Aif1 TGATGAGGATCTGCCGTCCAAACT TCTCCAGCATTCGCTTCAAGGACA
Cryaba GTCTGACCTCTTCTCAACAGC ATCTGTCCTTCTCCAAACGC
Cxcl1a CCAAACCGAAGTCATAGCCA GTGCCATCAGAGCAGTCT
Cxcl10a ATTTTCTGCCTCATCCTGCT TGATTTCAAGCTTCCCTATGGC
Il1ba CTCTTGTTGATGTGCTGCTG GACCTGTTCTTTGAAGTTGACG
Tbpa TTCACCAATGACTCCTATGACC CAAGTTTACAGCCAAGATTCACG
Lcn2a CTACAATGTCACCTCCATCCTG CCTGTGCATATTTCCCAGAGT
Nfe2l2a TCAAACACTTCTCGACTTACTCC TGATGGACTTGGAGTTGCC
Nqo1a GCCAATGCTGTAAACCAGTTG GCTCCATGTACTCTCTTCAGG
Mog GCTTCTTCAGAGACCACTCTT GATAGGCACAAGTGCGATGA
Plp1 CCTGTTTATTGCTGCGTTTGT TAAGGACGGCGAAGTTGTAAC
  1. aDenotates primers that were ordered pre-designed from IDT prime-time
\