Skip to main content

Table 2 List of primers used for RT-PCR

From: Inhibition of TLR4 signaling protects mice from sensory and motor dysfunction in an animal model of autoimmune peripheral neuropathy

Primers Forward Reverse
GAPDH GTGAAGGTCGGTGTGAAC AATCTCCACTTTGCCACTG
IL-10 CTATGCTGCCTGCTCTTA GCTGGTCCTTTGTTTGAAA
IFN-γ TCCACATCTATGCCACTTGAG CTGAGACAATGAACGCTACACA
IL-1β CTATACCTGTCCTGTGTA GCTCTTGACTTCTATCTTG
IL-6 CTGAAACTTCCAGAGATAC TTCATGTACTCCAGGTAG
TNF-α TTCTGTCTACTGAACTTC CCATAGAACTGATGAG
\